{"id":1692,"date":"2015-02-06T13:00:25","date_gmt":"2015-02-06T18:00:25","guid":{"rendered":"http:\/\/www.ambrosiasymbiosis.org\/labprotocols\/miseq-library-prep-for-fungus-community-metabarcoding\/"},"modified":"2015-10-19T08:34:14","modified_gmt":"2015-10-19T12:34:14","slug":"miseq-library-prep-for-fungus-community-metabarcoding","status":"publish","type":"post","link":"https:\/\/www.ambrosiasymbiosis.org\/labprotocols\/miseq-library-prep-for-fungus-community-metabarcoding\/","title":{"rendered":"MiSeq library prep for fungus community metabarcoding"},"content":{"rendered":"

Nested PCR<\/h4>\n
    \n
  1. The initial DNA extract template is subjected to amplification with the template-specific primers LR0R and JHY-LSU-369rc for 30 cycles. The number of cycles is lower than usual to prevent various biases resulting from excessive amplification.<\/li>\n
  2. PCR reactions are not cleaned up, to avoid loss of DNA (we used to do it, but it is probably not necessary).<\/li>\n
  3. 5\u03bcl of each amplicon is run on a gel to assess failures\/successes. You may not see very much on your gel! Even faint band should be used. When band is invisible, I wouldn\u2019t use it even though there may still be some amplicon \u2013 it was probably not a good unbiased amplification.<\/li>\n
  4. A 1-\u03bcl aliquot of each successful amplicon is used as a subsequent PCR template and subjected to a 20-cycle<\/strong> amplification with the fusion primers.<\/li>\n
  5. The secondary (final) amplicons are cleaned up with AmPure DNA cleanup kit.<\/li>\n
  6. The DNA concentration in each cleaned PCR product is measured using the PicoGreen-based Quant-iT kit<\/a>.<\/li>\n
  7. Products are pooled in equimolar proportions to create an amplicon library at a final concentration of 10\u2009ng\u2009\u03bcl\u22121.<\/li>\n
  8. The pooled amplicon library is cleaned up using UltraClean PCR clean-up kit and submitted to ICBR.<\/li>\n
  9. When submitting to ICBR, make sure you specify that we need raw output, non-demultiplexed fastq data.<\/li>\n<\/ol>\n

    The LSU fusion primers<\/h4>\n

    LR0R \u2013> JH-LSU-369rc: From 5\u2019 of the first primer site to the 3\u2019 end of the reverse primer: 400bp. The most variable region (positions): 100-240<\/p>\n

    Primer construction<\/strong>
    \nTo prepare an order, simply concatenate. You need one Forward, and as many Reverse as you need barcodes. We order form IDT, which only does synthesis at 100nM for oligos this long. I have negotiated this synthesis for the price of 25nM synthesis, so do purchases through me. Specify that you want them in the \u201cLab Ready\u201d suspension.
    \nForward primer:<\/strong>
    \nP5 AATGATACGGCGACCACCGA
    \nLinker GATCT
    \nSBS3 ACACTCTTTCCCTACACGACGCTCTTCCGATCT
    \nLR0R ACCCGCTGAACTTAAGC<\/p>\n

    Reverse primer:<\/strong>
    \nP7 CAAGCAGAAGACGGCATACGA
    \nLinker GAT
    \nBarcode xxxxxxx
    \nSBS12 GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT
    \nJH-LS-369rc CTTCCCTTTCAACAATTTCAC<\/p>\n

    Barcodes:<\/strong>
    \nWe already have the JH-LS-369rc fusion primers with these barcodes :
    \n1 AAGGTGG
    \n8 GCTGAGG
    \n15 ACAGCGG
    \n23 CATGGTG
    \n31 TCGGTTG
    \n35 CGAGATG
    \n41 TGTGCTG
    \n45 CTAGGAG
    \n51 TATGTAG
    \n56 GTGGAAG
    \n60 TAATCAG
    \n64 TCTGGCG
    \n70 CCAGTCG
    \n75 CTGTACG
    \n78 GATGCCG
    \n80 ACGTGGT
    \n85 TCTGTGT
    \n93 TAAGAGT
    \n98 GTTGCGT
    \n103 ATTGGTT
    \n109 CTGGATT
    \n114 TAGGCTT
    \n120 GGTGGAT
    \n127 CAAGTAT
    \n134 TCGTAAT
    \n138 CCGGCAT
    \n142 AATTGCT
    \n146 ACGGTCT
    \n150 GAGGACT
    \n155 TTAGCCT
    \n158 CATTGGA
    \n167 GATCTGA
    \n176 GCTGGTA
    \n181 AGTGACA
    \n189 TTCAGGC
    \n202 GACGGTC
    \nOther available barcodes:
    \n2 CTTGTGG
    \n3 TGAGTGG
    \n4 CAATTGG
    \n5 TTCTTGG
    \n6 GGTATGG
    \n7 GTGCTGG
    \n9 ATCGAGG
    \n10 GAGTAGG
    \n11 TGTTAGG
    \n12 AGGAAGG
    \n13 TCGCAGG
    \n14 AATCAGG
    \n16 TACGCGG
    \n17 ATGTCGG
    \n18 GGATCGG
    \n19 CAGACGG
    \n20 GTCACGG
    \n21 CGTCCGG
    \n22 TTACCGG
    \n24 TAGTGTG
    \n25 AGATGTG
    \n26 CTCTGTG
    \n27 ACTAGTG
    \n28 TGCAGTG
    \n29 ATGCGTG
    \n30 GCACGTG
    \n32 GTAGTTG
    \n33 AGCGTTG
    \n34 CTGATTG
    \n36 ACGTATG
    \n37 TTATATG
    \n38 GTTAATG
    \n39 AACAATG
    \n40 CAGCATG
    \n42 GCCGCTG
    \n43 AATTCTG
    \n44 CCATCTG
    \n46 CCTTGAG
    \n47 GGAAGAG
    \n48 CACAGAG
    \n49 TGGCGAG
    \n50 GATCGAG
    \n52 GCGTTAG
    \n53 ATATTAG
    \n54 TCCATAG
    \n55 AGTCTAG
    \n57 TGCGAAG
    \n58 CTCCAAG
    \n59 ATTGCAG
    \n61 AGCTCAG
    \n62 GCTACAG
    \n63 AAGCCAG
    \n65 GTCGGCG
    \n66 AAGAGCG
    \n67 CTTAGCG
    \n68 CCGCGCG
    \n69 TAACGCG
    \n71 TGGTTCG
    \n72 AGAATCG
    \n73 CATCTCG
    \n74 ATCCTCG
    \n76 GCATACG
    \n77 GGCAACG
    \n79 TCGACCG
    \n81 CTATGGT
    \n82 CGTAGGT
    \n83 GACAGGT
    \n84 AGACGGT
    \n86 ATAGTGT
    \n87 TAGTTGT
    \n88 GCATTGT
    \n89 AGCTTGT
    \n90 CCGATGT
    \n91 AATATGT
    \n92 CTCCTGT
    \n94 CACTAGT
    \n95 GTGAAGT
    \n96 TCCAAGT
    \n97 CGGCAGT
    \n99 CGAGCGT
    \n100 CCTTCGT
    \n101 TGGACGT
    \n102 GAGCCGT
    \n104 TCAGGTT
    \n105 GTGTGTT
    \n106 AGGAGTT
    \n107 CCTCGTT
    \n108 TACCGTT
    \n110 GGCGATT
    \n111 GCTTATT
    \n112 TATAATT
    \n113 AGTCATT
    \n115 CGGTCTT
    \n116 ATCTCTT
    \n117 GCGACTT
    \n118 CTTACTT
    \n119 GTACCTT
    \n121 AACGGAT
    \n122 GAATGAT
    \n123 CGCTGAT
    \n124 TTGAGAT
    \n125 ACAAGAT
    \n126 GCGCGAT
    \n128 GCCGTAT
    \n129 CTGTTAT
    \n130 TGATTAT
    \n131 GAGATAT
    \n132 GTTCTAT
    \n133 AGCAGGA
    \n135 GTCTAAT
    \n136 CATCAAT
    \n137 GGACAAT
    \n139 AGTACAT
    \n140 TACACAT
    \n141 TCTCCAT
    \n143 TTCTGCT
    \n144 GCTAGCT
    \n145 TGAAGCT
    \n147 CGTGTCT
    \n148 TCACTCT
    \n149 GGCCTCT
    \n151 AGATACT
    \n152 CTCAACT
    \n153 TTGCACT
    \n154 AACCACT
    \n156 GGTTCCT
    \n157 ATGACCT
    \n159 GCCTGGA
    \n160 CTGAGGA
    \n161 TAGCGGA
    \n162 ACTCGGA
    \n163 GTACGGA
    \n164 CGCGTGA
    \n165 TTAATGA
    \n166 AGGCTGA
    \n168 CCACTGA
    \n169 CTAGAGA
    \n170 GACGAGA
    \n171 CCGTAGA
    \n172 TTCCAGA
    \n173 AATGCGA
    \n174 TGCTCGA
    \n175 TCTACGA
    \n177 TCGAGTA
    \n178 GTCAGTA
    \n179 CGGCGTA
    \n180 ACAGTTA
    \n182 TATTACA
    \n183 CGGAACA
    \n184 CTTCACA
    \n185 CTGGCCA
    \n186 ACCGCCA
    \n187 TCATCCA
    \n188 TTCACCA
    \n190 GTCGTGC
    \n191 CAGCTGC
    \n192 TGTCTGC
    \n193 ACGGAGC
    \n194 CGTGAGC
    \n195 TTGTAGC
    \n196 GGCTAGC
    \n197 GTTCAGC
    \n198 AGCGCGC
    \n199 GATTCGC
    \n200 CTCTCGC
    \n201 GCACCGC
    \n203 ACCTGTC
    \n204 GGTAGTC
    \n205 AATCGTC<\/p>\n","protected":false},"excerpt":{"rendered":"

    Nested PCR The initial DNA extract template is subjected to amplification with the template-specific primers LR0R and JHY-LSU-369rc for 30 cycles. The number of cycles is lower than usual to prevent various biases resulting from excessive amplification. PCR reactions are not cleaned up, to avoid loss of DNA (we used to do it, but it […]<\/p>\n","protected":false},"author":2,"featured_media":0,"comment_status":"open","ping_status":"open","sticky":false,"template":"","format":"standard","meta":{"_s2mail":"yes","footnotes":""},"categories":[3],"tags":[],"class_list":["post-1692","post","type-post","status-publish","format-standard","hentry","category-general-molecular-work"],"_links":{"self":[{"href":"https:\/\/www.ambrosiasymbiosis.org\/labprotocols\/wp-json\/wp\/v2\/posts\/1692","targetHints":{"allow":["GET"]}}],"collection":[{"href":"https:\/\/www.ambrosiasymbiosis.org\/labprotocols\/wp-json\/wp\/v2\/posts"}],"about":[{"href":"https:\/\/www.ambrosiasymbiosis.org\/labprotocols\/wp-json\/wp\/v2\/types\/post"}],"author":[{"embeddable":true,"href":"https:\/\/www.ambrosiasymbiosis.org\/labprotocols\/wp-json\/wp\/v2\/users\/2"}],"replies":[{"embeddable":true,"href":"https:\/\/www.ambrosiasymbiosis.org\/labprotocols\/wp-json\/wp\/v2\/comments?post=1692"}],"version-history":[{"count":4,"href":"https:\/\/www.ambrosiasymbiosis.org\/labprotocols\/wp-json\/wp\/v2\/posts\/1692\/revisions"}],"predecessor-version":[{"id":1802,"href":"https:\/\/www.ambrosiasymbiosis.org\/labprotocols\/wp-json\/wp\/v2\/posts\/1692\/revisions\/1802"}],"wp:attachment":[{"href":"https:\/\/www.ambrosiasymbiosis.org\/labprotocols\/wp-json\/wp\/v2\/media?parent=1692"}],"wp:term":[{"taxonomy":"category","embeddable":true,"href":"https:\/\/www.ambrosiasymbiosis.org\/labprotocols\/wp-json\/wp\/v2\/categories?post=1692"},{"taxonomy":"post_tag","embeddable":true,"href":"https:\/\/www.ambrosiasymbiosis.org\/labprotocols\/wp-json\/wp\/v2\/tags?post=1692"}],"curies":[{"name":"wp","href":"https:\/\/api.w.org\/{rel}","templated":true}]}}